rs2103263 chr2:155981422 T>C
- Sequence
cttgtgagaactcactcactatca[T/C]gagaacagcaagggaaaaatcccc
- ASB in cell types
- MDM(monocyte derived macrophages) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MDM(monocyte derived macrophages) | -4.23 | 2.47 | 2.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.91 | 0.33 | 1.12 |
Items per page:
1 – 2 of 2