rs2104259 chr1:58786382 C>G
- Sequence
acattcctttgtattttctctact[C/G]tggcaaactttcttgtggagtatt
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.03 | 0.77 | 1.83 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder, diabetic retinopathy in type 2 diabetes mellitus, ldl cholesterol change with statins, mitral annular calcium