rs2104662 chr9:80631052 C>T
- Sequence
acaacaacaacaacaaaaaaatga[C/T]tcatccccaaaacttggggagact
- ASB in cell types
- HCASMC (Human coronary artery smooth muscle cells)
- ASB for transcription factors
- JUND_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| JUND_HUMAN | 3.25 | -4.79 | 1.33 | -5.46 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP diastolic blood pressure (dbp), lp-pla2 mass, total cholesterol, triglycerides change with statins