rs2105713 chr18:44098750 G>A
- Sequence
ggctcttggccacatggcaacttc[G/A]tattttcttatatttgtagccatg
- ASB in cell types
- 2588 (Lymphoblastoid Cell Lines) HMEC (human mammary epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 2588 (Lymphoblastoid Cell Lines) | 0.98 | n/a | 2.00 | |||
| HMEC (human mammary epithelial cells) | 0.08 | 1.81 | 1.00 |
Items per page:
1 – 2 of 2