rs210840 chr8:40373409 C>T
- Sequence
ggaaagtgttgcagaatcacattt[C/T]aaaaaatgcctttctgttccagag
- ASB in cell types
- LNCaP (prostate carcinoma) T47D (invasive ductal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LNCaP (prostate carcinoma) | -0.08 | 0.79 | 1.37 | |||
| T47D (invasive ductal carcinoma) | 0.54 | -0.15 | 1.47 |
Items per page:
1 – 2 of 2