rs210896 chr6:11729207 G>T
- Sequence
tctttctttcggtgttaaccctca[G/T]gtcacgtctttccagcccaggaga
- ASB in cell types
- primary B-CLL cells
- ASB for transcription factors
- BRD4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BRD4_HUMAN | -0.44 | 3.30 | 2.50 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), diastolic blood pressure (dbp), total cholesterol, urinary albumin-to-creatinine ratio