rs210905 chr6:11723305 A>G
- Sequence
tttccaggtgaaggggagaggcag[A/G]cacggaagaagcgcatctgtagct
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- ELF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ELF1_HUMAN | 1.69 | -1.48 | 1.00 | -1.88 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
