rs210919 chr6:11710327 G>A
- Sequence
cctctgtaatctacaaccggatgc[G/A]ctcttacacccaagccttgatggg
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia) activated primary CD4+ T cells from blood
- ASB for transcription factors
- ETS1_HUMAN NFAC2_HUMAN FLI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ETS1_HUMAN | -2.34 | 2.91 | 1.00 | -1.54 | Weak Discordant | |||
| NFAC2_HUMAN | 2.92 | -5.13 | 2.00 | n/a | No Hit | |||
| FLI1_HUMAN | 0.34 | 2.43 | 1.00 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), alzheimers disease, aortic valve calcium, college completion, paternal transmission distortion, schizophrenia, spine bone mineral density (bmd), tetrology of fallot, transmission distortion