rs210920 chr6:11710321 G>A
- Sequence
tttatgcctctgtaatctacaacc[G/A]gatgcgctcttacacccaagcctt
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia) GM12878 (female B-cells lymphoblastoid cell line) Th1-cells
- ASB for transcription factors
- ETS1_HUMAN TBX21_HUMAN NFAC2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ETS1_HUMAN | 2.90 | -3.35 | 1.00 | -4.29 | Concordant | |||
| TBX21_HUMAN | 2.18 | -1.82 | 1.00 | n/a | No Hit | |||
| NFAC2_HUMAN | 2.68 | 0.97 | 2.00 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GRASP college completion, hdl cholesterol, plasma brain natriuretic peptide (bnp), prop taste detection threshold, rheumatoid arthritis, transmission distortion, years of education