rs2109265 chr17:62875908 G>A
- Sequence
aagctcctgcacaatgctcagctc[G/A]tgagtgctccaaggaaaacatttc
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) MCF7L-P(immortalized breast epithelial cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.20 | 1.16 | 2.14 | |||
| MCF7L-P(immortalized breast epithelial cell line) | -0.07 | 1.71 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP age at death with kuru exposure, autism with low iq, eye color, height, hypertension (early onset hypertension), parkinsons disease, spine bone mineral density (bmd), tetrology of fallot
GTEx eQTL Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Heart_Atrial_Appendage