rs2116611 chr3:94965994 A>C
- Sequence
tttgatataccacgtttcattctt[A/C]gtcttttattacttctgtcaatag
- ASB in cell types
- MDM(monocyte derived macrophages)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MDM(monocyte derived macrophages) | 1.28 | -0.15 | 1.00 |
Items per page:
1 – 1 of 1