rs2118306 chr7:51162951 C>T
- Sequence
agccaatactcactgcaatgtttc[C/T]tgtaaagcaagaagtgctaagcta
- ASB in cell types
- GM19099 (female B-cells Lymphoblastoid Cell Lines) CD34+ stem cells-derived erythroblasts spleen
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19099 (female B-cells Lymphoblastoid Cell Lines) | 1.06 | -0.86 | 1.00 | |||
| CD34+ stem cells-derived erythroblasts | 2.51 | -4.74 | 2.00 | |||
| spleen | 1.01 | -0.47 | 1.00 |
Items per page:
1 – 3 of 3