rs2123034 chr2:160788661 T>G
- Sequence
ttgattgacaggaagagagtatga[T/G]aacacattttgtggtaataaaaat
- ASB in cell types
- ALL-SIL (acute lymphoblastic leukemia)
- ASB for transcription factors
- TLX1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TLX1_HUMAN | -4.57 | 2.68 | 1.50 | n/a | n/a |
Items per page:
1 – 1 of 1