rs2125146 chr5:114407931 C>A
- Sequence
gattttcagacttctgccaggttg[C/A]gaaagaacagttagtgtttctaca
- ASB in cell types
- EOL-1 (Acute myeloid leukemia)
- ASB for transcription factors
- SMRC1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMRC1_HUMAN | 3.66 | -4.00 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), diabetic retinopathy in type 2 diabetes mellitus, hypertension (early onset hypertension), salmonella-induced pyroptosis, sporadic creutzfeldt-jakob disease, total cholesterol, triglycerides change with statins