rs213027 chr1:21325167 G>T
- Sequence
tagctgacactaaacacagagacg[G/T]ggcccttgtgactagatgaaccat
- ASB in cell types
- MOLM14 (Adult acute myeloid leukemia) CD14+ monocytes
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MOLM14 (Adult acute myeloid leukemia) | 1.41 | -0.38 | 1.00 | |||
| CD14+ monocytes | 2.03 | n/a | 2.00 |
Items per page:
1 – 2 of 2