rs213037 chr1:21329391 G>A
- Sequence
aggtgagactcaccagaaaggggc[G/A]tggccttcataacctggtattctt
- ASB in cell types
- 22RV1 (prostate carcinoma)
- ASB for transcription factors
- ESR1_HUMAN ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 1.63 | 2.04 | 2.33 | n/a | No Hit | |||
| ANDR_HUMAN | 2.46 | -1.50 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), aortic valve calcium, college completion, sporadic creutzfeldt-jakob disease, stabilized warfarin dose, tetrology of fallot