rs2134062 chr18:23359328 A>G
- Sequence
aatctgggaggcagaggttgcagt[A/G]agccgagattgtcccactgcactc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) GM02630 (Fanconi anemi)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.86 | 0.26 | 1.04 | |||
| GM02630 (Fanconi anemi) | 1.72 | -0.41 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Brain_Cerebellum, Esophagus_Mucosa, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid