rs214085 chr11:17277109 C>T
- Sequence
agcaggagagggtaggtgccaaac[C/T]gagaccctggcggggtcccttcgg
- ASB in cell types
- K562 (myelogenous leukemia) MV-4-11 (Childhood acute monocytic leukemia)
- ASB for transcription factors
- CDK9_HUMAN KMT2A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CDK9_HUMAN | 2.17 | 1.23 | 1.00 | n/a | n/a | |||
| KMT2A_HUMAN | 1.58 | -0.58 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Mucosa, Heart_Left_Ventricle, Liver, Lung, Nerve_Tibial, Ovary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Whole_Blood