rs2142172 chr7:151341872 T>C
- Sequence
tgaggacacggcggccgagtgtcc[T/C]cgaccccagcctcagcagcactgc
- ASB in cell types
- HEK293 (embryonic kidney) 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 1.04 | 0.17 | 2.02 | |||
| 22RV1 (prostate carcinoma) | 2.71 | 0.58 | 2.00 |
Items per page:
1 – 2 of 2