rs214485 chr21:25882009 C>A
- Sequence
gtggaaaccttgacgcgcttgcaa[C/A]gtgtccagtggttgtttctggttc
- ASB in cell types
- CD34+ stem cells-derived erythroblasts
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CD34+ stem cells-derived erythroblasts | 1.82 | -1.52 | 3.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Lung, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid