rs2147190 chr13:91406634 T>C
- Sequence
agccattgatacccttcaaagttc[T/C]ctgacccagacacttcccaatttc
- ASB in cell types
- K562 (myelogenous leukemia) bipolar neuron
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.31 | 0.93 | 5.00 | |||
| bipolar neuron | n/a | 2.59 | 1.00 |
Items per page:
1 – 2 of 2