rs2148490 chr10:112308104 C>T
- Sequence
aaccacacctcttaaatgggatat[C/T]gactgcatcttgaagaagggtccc
- ASB in cell types
- HeLa-Tet-On GM12890 (Lymphoblastoid Cell Lines) prostate gland
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HeLa-Tet-On | -0.70 | 2.56 | 2.00 | |||
| GM12890 (Lymphoblastoid Cell Lines) | -0.64 | 1.06 | 1.00 | |||
| prostate gland | 2.27 | -1.79 | 1.00 |
Items per page:
1 – 3 of 3