rs214959 chr6:152381686 G>A
- Sequence
ttgcctgtggtggattgctcctgt[G/A]aatgattaaacccatatttccctc
- ASB in cell types
- HepG2 (hepatoblastoma)
- ASB for transcription factors
- FOXA3_HUMAN FOXK2_HUMAN RARA_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA3_HUMAN | -2.15 | 2.95 | 2.00 | n/a | No Hit | |||
| FOXK2_HUMAN | -1.23 | 1.89 | 1.50 | n/a | n/a | |||
| RARA_HUMAN | n/a | 1.96 | 1.00 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP age at menarche, alcohol dependence, alcohol dependence (early age of onset), comorbid depressive syndrome and alcohol dependence, hypertension (early onset hypertension), sporadic creutzfeldt-jakob disease