rs215101 chr16:15959116 C>G
- Sequence
tttccctaggaggttgtgggctgt[C/G]gaaattctagtgtaattggcttac
- ASB for transcription factors
- IKZF2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF2_HUMAN | 1.63 | -0.89 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, chronic kidney disease, cognitive response of healthy volunteers to topiramate treatment as measure by the color-word cognitive test, sporadic creutzfeldt-jakob disease, topiramate plasma level change in healthy volunteers in response to topiramate treatment, total cholesterol