rs2158328 chr7:96326905 G>C
- Sequence
aggggaagcaaacatgtccttcac[G/C]tggcagcagaaaggagaagtgctg
- ASB in cell types
- GM12891 (male B- cells lymphoblastoid cell line) monocyte-derived dendritic cells
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12891 (male B- cells lymphoblastoid cell line) | 2.50 | -2.08 | 1.42 | |||
| monocyte-derived dendritic cells | 2.67 | -0.35 | 1.75 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Lung, Muscle_Skeletal, Pituitary, Whole_Blood