rs215927 chr6:84774965 T>C
- Sequence
agcctagcccagcacctcccgccg[T/C]ctcaggctcggaggagctctgtac
- ASB in cell types
- GM02255 (Lymphoblastoid Cell Lines) RWPE1 (prostate epithelial cells) RCC 7860 (Renal cell carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02255 (Lymphoblastoid Cell Lines) | 1.45 | -1.28 | 1.00 | |||
| RWPE1 (prostate epithelial cells) | 1.35 | -1.35 | 1.00 | |||
| RCC 7860 (Renal cell carcinoma) | 2.60 | n/a | 2.00 |
Items per page:
1 – 3 of 3