rs216091 chr16:107143 A>G
- Sequence
gcgtaggtcaggaaagaatgctac[A/G]tgctgaacaacagcttaggagcct
- ASB in cell types
- K562 (myelogenous leukemia) MM1.S (plasma cell myeloma) T47D (invasive ductal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.00 | 0.99 | 2.01 | |||
| MM1.S (plasma cell myeloma) | 1.84 | -1.84 | 1.11 | |||
| T47D (invasive ductal carcinoma) | 0.02 | 0.81 | 2.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP ldl cholesterol change with statins, refractive error, total cholesterol change with statins, triglycerides change with statins, urinary albumin-to-creatinine ratio
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Tibial, Brain_Cerebellar_Hemisphere, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood