rs216175 chr17:2264396 A>C
- Sequence
atgagatgccaaaactacatcttt[A/C]cattggctttgaacaagtccctca
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 1.16 | 0.45 | 1.01 | |||
| HEK293 (embryonic kidney) | 0.54 | 0.77 | 1.62 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP hip bone mineral density (bmd), ldl cholesterol, parkinsons disease, prop taste detection threshold, total cholesterol
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood