rs2165933 chr5:113163509 G>A
- Sequence
ctttctctttcctccttttttcct[G/A]taacccttagtatgacctgacatc
- ASB in cell types
- Detroit 562 (Pharyngeal squamous cell carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| Detroit 562 (Pharyngeal squamous cell carcinoma) | 2.01 | -0.19 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Skin_Not_Sun_Exposed_Suprapubic, Testis, Thyroid, Whole_Blood