rs216982 chr8:89617217 A>G
- Sequence
ttaatgtccgttttcttttgctat[A/G]gcgacacctactgttattgctggt
- ASB in cell types
- GM12890 (Lymphoblastoid Cell Lines) tibial nerve LUHMES (lund human mesencephalic cells) heart left ventricle
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.29 | 0.36 | 1.58 | 0.16 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
