rs217062 chr11:88327331 T>C
- Sequence
acctatggtgctttcaatacttgt[T/C]cccagttccctttttcatatctca
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) MDM(monocyte derived macrophages) macrophages form periferal blood
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.86 | 0.80 | 1.07 | |||
| MDM(monocyte derived macrophages) | 1.77 | -0.12 | 3.00 | |||
| macrophages form periferal blood | 0.99 | 1.36 | 2.00 |
Items per page:
1 – 3 of 3