rs217513 chr7:28505257 C>T
- Sequence
cacacacgcacatacaccctttta[C/T]tttcactctcagatcttgtccata
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- BHE40_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BHE40_HUMAN | 2.03 | n/a | 1.33 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP diastolic blood pressure (dbp), hdl cholesterol, rheumatoid arthritis, rheumatoid arthritis, combined control dataset, rheumatoid arthritis, cyclic citrullinated peptide (ccp) positive, tetrology of fallot