rs2178026 chr7:73647689 C>G
- Sequence
gcgcctctatgggcagaggggaaa[C/G]tgaggcccagcacagaggcggatc
- ASB in cell types
- HCT-116 (colon carcinoma)
- ASB for transcription factors
- ZFX_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZFX_HUMAN | -0.19 | 1.91 | 1.00 | n/a | No Hit | |||
| CTCF_HUMAN | 0.35 | 1.08 | 1.41 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Lung