rs217847 chr5:37367135 T>C
- Sequence
tcacagctcagggcaacctcagcc[T/C]cttgggctcaagcaatcttccacc
- ASB for transcription factors
- ZN600_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZN600_HUMAN | n/a | 3.08 | 3.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Coronary, Artery_Tibial, Cells_EBV-transformed_lymphocytes, Esophagus_Gastroesophageal_Junction, Lung, Nerve_Tibial, Thyroid, Whole_Blood