rs217959 chrX:119391556 G>A
- Sequence
tttccagcctccggatctgtaagc[G/A]atcaatttttgttctttataaatt
- ASB in cell types
- GM19240 (B cells Lymphoblastoid Cell Lines) GM12878 (female B-cells lymphoblastoid cell line) GM19238 (female B-cells lymphoblastoid cell lines) GM12892 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19240 (B cells Lymphoblastoid Cell Lines) | n/a | 3.09 | 2.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 1.61 | -0.39 | 2.40 | |||
| GM19238 (female B-cells lymphoblastoid cell lines) | -1.29 | 1.69 | 1.50 | |||
| GM12892 (female B-cells lymphoblastoid cell line) | 1.52 | -3.76 | 2.00 |
Items per page:
1 – 4 of 4