rs218115 chr7:31443664 C>T
- Sequence
gatccctaagatccccaaagacaa[C/T]agatgagctctcaccatgctcctg
- ASB in cell types
- T47D (invasive ductal carcinoma) adrenal gland
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| T47D (invasive ductal carcinoma) | 0.17 | 1.30 | 1.04 | |||
| adrenal gland | 1.42 | -1.12 | 1.00 |
Items per page:
1 – 2 of 2