rs2182046 chr9:112863419 C>T
- Sequence
gagagagaagccagctttgggaag[C/T]gctgcagccacaaagcccaaactc
- ASB in cell types
- MDM(monocyte derived macrophages) monocyte-derived macrophages from peripheral blood macrophages form periferal blood
- ASB for transcription factors
- SPI1_HUMAN TF65_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | -0.16 | 2.51 | 1.76 | n/a | No Hit | |||
| TF65_HUMAN | n/a | 3.47 | 2.50 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP alcohol dependence without depressive symptoms, arthritis including non-rheumatoid, body mass index (bmi), comorbid depressive syndrome and alcohol dependence, irritible bowel syndrome, obesity (body mass index (bmi)), schizophrenia