rs2182146 chr1:38745886 C>T
- Sequence
caaatccatccccactggtgggga[C/T]tgtcgatcatatggccctacctcc
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- PKNX1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PKNX1_HUMAN | 3.80 | -3.46 | 1.00 | -3.12 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), ldl cholesterol change with statins, total cholesterol change with statins, years of education