rs218634 chr21:36422623 G>A
- Sequence
gagtccgaccatgcctccaggact[G/A]acatgtctgctggttgtcgttgac
- ASB in cell types
- K562 (myelogenous leukemia) SK-N-SH (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.83 | 0.54 | 1.06 | |||
| SK-N-SH (neuroblastoma) | 1.41 | -1.41 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), diastolic blood pressure (dbp), kidney stones, serum creatinine