rs218641 chr21:36430065 G>A
- Sequence
ggcagcagaggaaacagcagcttc[G/A]cagagcagcctggcccgagtggct
- ASB in cell types
- K562 (myelogenous leukemia) GM02610 (Lymphoblastoid Cell Lines) GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.41 | 1.37 | 1.24 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Stomach, Testis