rs218642 chr21:36430331 T>C
- Sequence
ctcctgagtcacaggctcagaagc[T/C]ttcgcctccgccttcagactggcc
- ASB in cell types
- K562 (myelogenous leukemia) GM12878 (female B-cells lymphoblastoid cell line) ARP-1(Plasma cell myeloma) SUM159PT (Triple negative breast cancer)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.74 | 0.63 | 1.07 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.72 | 0.68 | 1.01 | |||
| ARP-1(Plasma cell myeloma) | 1.74 | -3.20 | 1.50 | |||
| SUM159PT (Triple negative breast cancer) | 1.09 | -0.09 | 1.00 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Heart_Atrial_Appendage, Muscle_Skeletal, Skin_Sun_Exposed_Lower_leg, Testis