rs2189332 chr17:34081686 C>G
- Sequence
gaatttcacaaattataatttgct[C/G]tatcttttcccacctaaattttac
- ASB in cell types
- 2588 (Lymphoblastoid Cell Lines) GM02610 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 2588 (Lymphoblastoid Cell Lines) | 1.48 | -0.52 | 1.00 | |||
| GM02610 (Lymphoblastoid Cell Lines) | 1.25 | -0.78 | 1.00 |
Items per page:
1 – 2 of 2