rs221005 chr7:100803811 A>G
- Sequence
ggggtagggctggaggccagaggc[A/G]gggcctttggcttgggtgccaggg
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) CTV-1 (Adult T acute lymphoblastic leukemia) MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- RFX5_HUMAN SPI1_HUMAN IKZF1_HUMAN IKZF2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RFX5_HUMAN | 0.02 | 0.67 | 1.75 | n/a | No Hit | |||
| SPI1_HUMAN | -0.40 | 2.17 | 1.62 | n/a | No Hit | |||
| IKZF1_HUMAN | 0.23 | 1.78 | 1.38 | n/a | No Hit | |||
| IKZF2_HUMAN | -0.97 | 1.59 | 1.00 | n/a | n/a |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Cerebellum, Brain_Hypothalamus, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Liver, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid, Whole_Blood