rs2222394 chr18:22668325 T>C
- Sequence
agaatgatagaaatgtcttacttt[T/C]ttggaaactagataaacaagaata
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) HASM2 (Human airway smooth muscle 2)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.38 | 1.08 | 1.07 | |||
| HASM2 (Human airway smooth muscle 2) | 0.24 | 1.06 | 1.00 |
Items per page:
1 – 2 of 2