rs2227312 chr1:2556224 C>A
- Sequence
tcggcaaaaatgtcagtcagcgcc[C/A]cggggagcagccgagggtccctga
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia) GM12878 (female B-cells lymphoblastoid cell line) GM02610 (Lymphoblastoid Cell Lines) L1236 (Hodgkin lymphoma)
- ASB for transcription factors
- CTCF_HUMAN FLI1_HUMAN ELF1_HUMAN NFKB1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.80 | 1.55 | 1.06 | 2.73 | Concordant | |||
| FLI1_HUMAN | -0.15 | 0.97 | 1.00 | n/a | No Hit | |||
| ELF1_HUMAN | -1.97 | 2.15 | 1.00 | n/a | No Hit | |||
| NFKB1_HUMAN | -1.54 | 2.49 | 2.00 | n/a | No Hit | |||
| SMCA4_HUMAN | 0.91 | 1.36 | 1.06 | n/a | n/a |
Items per page:
1 – 5 of 5
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Nucleus_accumbens_basal_ganglia, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Liver, Lung, Nerve_Tibial, Ovary, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Thyroid, Whole_Blood