rs222850 chr17:7234631 C>G
- Sequence
gaccgtctgactccgcctagtgcc[C/G]ccgccacatgatcgctgccttcag
- ASB in cell types
- HepG2 (hepatoblastoma) A549 (lung carcinoma) HCT-116 (colon carcinoma) CD34+ hematopoietic stem cells-derived proerythroblasts
- ASB for transcription factors
- NFE2_HUMAN USF2_HUMAN TYY1_HUMAN E4F1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NFE2_HUMAN | -0.76 | 1.48 | 1.38 | n/a | No Hit | |||
| USF2_HUMAN | -0.06 | 0.36 | 1.58 | 0.01 | Weak Concordant | |||
| TYY1_HUMAN | -0.09 | 3.09 | 1.75 | n/a | No Hit | |||
| E4F1_HUMAN | -1.46 | 2.01 | 1.25 | n/a | n/a |
Items per page:
1 – 4 of 4
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Whole_Blood