rs223015 chr7:74165114 A>G
- Sequence
tgtgccttgccaagctcacttcaa[A/G]gacagttataacgctgtccaaata
- ASB in cell types
- foreskin keratinocyte pancreas EOL-1 (Acute myeloid leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.36 | 2.59 | 2.67 | |||
| pancreas | -2.44 | 1.61 | 1.33 | |||
| EOL-1 (Acute myeloid leukemia) | 2.17 | -1.74 | 1.00 |
Items per page:
1 – 3 of 3