rs2231516 chr8:140511052 G>C
- Sequence
ttcaagaaagcgtcactttttgcc[G/C]acggcggcacgcccggtcctagta
- ASB in cell types
- GM12891 (male B- cells lymphoblastoid cell line) breast tumor LNCaP (prostate carcinoma) MOLT-4 (Adult T acute lymphoblastic leukemia)
- ASB for transcription factors
- STAG1_HUMAN CREB1_HUMAN MAFK_HUMAN SPT5H_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 3.27 | -3.29 | 1.22 | n/a | n/a | |||
| CREB1_HUMAN | 1.57 | -0.28 | 1.48 | n/a | No Hit | |||
| MAFK_HUMAN | 2.31 | -2.01 | 1.00 | n/a | No Hit | |||
| SPT5H_HUMAN | 1.48 | -1.67 | 1.50 | n/a | n/a | |||
| ESR1_HUMAN | 0.31 | 3.01 | 1.75 | n/a | No Hit |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Ovary, Pancreas, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Thyroid