rs2232909 chr20:36605789 C>T
- Sequence
gcggcgcctgctctgtagagccgg[C/T]ggaaccgggtagcttggccaggtt
- ASB in cell types
- 22RV1 (prostate carcinoma) neutrophils
- ASB for transcription factors
- ANDR_HUMAN GMEB2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 3.00 | 0.24 | 2.00 | n/a | No Hit | |||
| GMEB2_HUMAN | 2.06 | -2.03 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Nerve_Tibial, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis