rs2232946 chr11:62242139 C>T
- Sequence
tggggaggtgacacagatggatgg[C/T]aacagccctgggaaggagaggtgg
- ASB in cell types
- breast tumor 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| breast tumor | 2.65 | -0.55 | 2.00 | |||
| 22RV1 (prostate carcinoma) | 2.51 | -4.75 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Breast_Mammary_Tissue, Esophagus_Mucosa, Heart_Atrial_Appendage, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg